iolR [2019-09-03 11:12:16]

transcriptional repressor of the iol operon, DeoR family

Locus: BSU_39770

Isoelectric point: 6.33

Molecular weight: 28.25 kDa

Protein length: 251 aa

Gene length: 756 bp

Function: regulation of myo-inositol catabolism

Product: transcriptional repressor

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Carbon metabolism → Utilization of specific carbon sources → Utilization of inositol
• Information processing → Regulation of gene expression → Transcription factors and their control → Transcription factors/ other

Gene

Coordinates: 4,084,799 4,085,554

Phenotypes of a mutant

• inactivation of iolR reduces sporulation efficiency to 38% that of wild type cells PubMed

The protein

Effectors of protein activity

• inducer: 2-deoxy-5-keto-D-gluconic acid-6-phosphate

Additional information

• information on binding sites can be found in the PRODORIC2 database

Expression and Regulation

Operons

• Genes: iolR-iolS
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • IolR: repression, PubMed, in IolR regulon

  Regulation

  • induced by inositol (IolR) PubMed

Biological materials

Mutant

• BKE39770 (iolR::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATAAAAAACTCCTTCTT, downstream forward: _UP4_TAACGTTTACAATAGTGTTG
• BKK39770 (iolR::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATAAAAAACTCCTTCTT, downstream forward: _UP4_TAACGTTTACAATAGTGTTG

Labs working on this gene/protein

• Yasutaro Fujita, University of Fukuyama, Japan
• [[Ken-ichi Yoshida]], Kobe University, Japan

References

Loading